Attotron Molecular Biology Hypertext Dictionary, copyright 1999 Attotron Biosensor Corporation. 1' carbon: by the conventional chemical nomenclature used to refer to the various carbon atoms in an organic molecule, the carbon to which the purine or pyrimidine base is attached to deoxyribose in DNA and to ribose in RNA is designated the 1' carbon, the adjacent carbon in the sugar the 2' carbon, the next carbon the 3', the next the 4', and the last the 5' carbon. Moieties or residues attached to a particular carbon are identified by the number of the carbon to which they are attached, such as the 5'-phosphate and the 3'-hydroxyl residues of a nucleic acid. 1' carbon: by the conventional chemical nomenclature used to refer to the various carbon atoms in an organic molecule, the carbon to which the purine or pyrimidine base is attached to deoxyribose in DNA and to ribose in RNA is designated the 1' carbon, the adjacent carbon in the sugar the 2' carbon, the next carbon the 3', the next the 4', and the last the 5' carbon. Moieties or residues attached to a particular carbon are identified by the number of the carbon to which they are attached, such as the 5'-phosphate and the 3'-hydroxyl residues of a nucleic acid. 3' cohesive DNA termini: the single-stranded, complementary regions of DNA that are formed when both of the strands of a double-stranded DNA molecule are cleaved in an asymmetric manner. The restriction endonuclease PstI, for example, cleaves its recognition sequence "CTGCAG" between the A and G to generate the 4-base, 3'-cohesive terminus "TGCA". PstI.GIF 3' to 5' orientation: the direction along a polynucleotide molecule as defined by proceeding from the 3'-hydroxyl terminus towards the 5'-phosphate terminus. This is the direction opposite to that in which DNA and RNA are synthesized enzymatically. An example of an enzyme which proceeds with this orientation is a 3'-5' exonuclease (a "proofreading" exonuclease), which can assist in correcting errors introduced during DNA replication. 3'-hydroxyl: the hydrogenated oxygen molecule attached to the 3', or third, carbon of either deoxyribose or ribose. 5' cohesive DNA termini: the single-stranded, complementary regions of DNA that are formed when both of the strands of a double-stranded DNA molecule are cleaved in an asymmetric manner. The restriction endonuclease EcoRI, for example, cleaves the sequence "GAATTC" between the G and A to generate the 4-base, 5'-cohesive terminus "AATT". EcoRI.GIF 5' end: In mRNA, the 5' end of a newly synthesized molecule corresponds to the transcription initiation point associated with a promoter. RNA processing steps and degradation may remove or modify this terminus so that the transcription initiation point is absent from the mature mRNA molecule and, consequently, from any cDNA made from the mature mRNA. By convention, nucleic acid sequences are written with th 5' end at the left. 5' terminus: the 5' end of a nucleic acid strand. 5' to 3' orientation: the direction along a polynucleotide molecule as defined by proceeding from the 5'-phosphate terminus towards the 3'-hydroxyl terminus or by extending a polynucleotide by the addition of residues to the 3'-hydroxyl terminus. 5' to 3' phosphate linkage: the oxygen-phosphorus-oxygen linkage that connects the 5' carbon of deoxyribose or ribose to the 3' carbon of the adjacent sugar molecule in a nucleic acid. 5'-phosphate: the oxygenated phosphorus atom attached through an oxygen molecule to the 5' carbon of deoxyribose or ribose. adenine: (A) the purine base found attached to the 1' carbon of deoxyribose in DNA, where it is capable of forming 2 hydrogen bond interactions with the pyrimidine thymine on an opposing nucleic acid strand, and attached to the 1' carbon of ribose in RNA, where it is capable of forming 2 hydrogen bond interactions with the pyrimidine uracil on an opposing nucleic acid strand. adenosine triphosphate: a ribose molecule with the purine adenine attached to the 1' carbon and a chain of three oxygenated phosphorus atoms attached to the 5' carbon. This is a high energy molecule that serves as a precursor for the assembly of RNA and provides energy for many other cellular reactions. agarose: a highly refined form of the polysaccharide agar, a polymer purified from seaweed, that can be mixed as a dry powder with a buffer solution, melted with heating, then poured into a mold and allowed to cool to form a solid gel matrix for the electrophoretic separation of macromolecules like DNA and RNA. Agrobacterium tumefaciens: the bacterial organism responsible for the formation of crown gall tumors on susceptible host plants. The gall formation is caused by the transfer of the T-DNA, a portion of the large Ti plasmid resident in the bacterium, to the host plant, where chromosomal integration and expression of T-DNA genes causes alterations in plant hormone levels. alkaline conditions: High pH (typically >pH10). pH is of particular concern during the purification, handling, and storage of nucleic acids. Alkaline conditions, are a pH of greater than 10, will destabilize the base pairing alleles: different copies of a gene sequence that can occur at the same chromosomal locus, or location, on different copies of the same chromosome. Different alleles are generally detected by the different phenotypic properties associated with allelic variants. allelic variations: different nucleotide sequence versions of the same genetic locus. (See alleles). alpha subunit: the smallest of the four subunit types present in most bacterial RNA polymerases, generally present in two copies per RNA polymerase complex. ampicillin: an antibiotic frequently used in the selection of bacterial transformants containing a cloning vector encoding resistance to this antibiotic, generally because of the presence of an ampicillin resistance gene derived from a transposable element. While this antibiotic is considered bacteriocidal in liquid culture, causing sensitive cells to lyse or rupture, it is bacteriostatic in solid media, allowing sensitive cells to exist as viable sphereoplasts with damaged cell walls until the ampicillin in the media degrades, allowing continued cell growth. This antibiotic is inactivated by the ampicillin resistance gene present in many cloning vectors. amplification: DNA cloning methods were developed in part as a response to the need to overcome the low yield of a given DNA fragment from a large genome, amplifying the yield of a desired DNA fragment during the purification process. Chloramphenicol amplification is the process of increasing plasmid yield from a bacterial culture by the addition of the protein synthesis inhibitor chloramphenicol, which blocks bacterial chromosomal replication while allowing continued replication of plasmids containing certain origins of replication. This procedure is most commonly used with plasmids containing an origin derived from a ColE1 plasmid, although it can also be used to obtain increased yields of bacteriophage M13 replicative form. PCR amplification is the use of the polymerase chain reaction to increase the amount of a specific DNA fragment. anneal: the ability of two complementary nucleic acids to align in an opposing orientation to allow the nucleotide bases of one strand to form hydrogen bonds with the nucleotide bases of the complementary strand. The ability of two single-stranded molecules to anneal to form a double-stranded form is influenced by several factors, including the amount of salt in the solution, the pH of the solution, the temperature of the solution, the size of the complementary region, and the percent GC base pairing in the complementary region. antiparallel: aligned with the two sugar-phosphate backbones in opposite orientations, with the 5' end of each polynucleotide aligned with the 3' end of the complementary polynucleotide. assembly of protein: the mRNA-template dependent, ribosome-mediated polymerization of amino acids into polypeptide chains asymmetric: an object with one side, end or aspect dfferent from another. A DNA strand is polar due to the asymmetric nature of the sugar-phosphate backbone. The 3' carbon of one sugar moiety is connected to the 5' carbon of the next, giving the overall strand distinguishable 5' and 3' ends. ATP: adenosine triphosphate. bacteriophage: a virus that infects bacteria. Bacteriophages have proven very useful in molecular biology as models of control of gene expression, as sources of enzymes, and as cloning vectors. Some that are particularly important in molecular biology include lambda, M13, and T4. base pairing: Nucleotide bases form the core of the double-stranded DNA helix. To maintain a constant distance between the two opposing sugar-phosphate backbones, it is necessary for the bases to align in combinations with similar dimensions, a requirement that is fulfilled by always aligning a purine (A or G) with a pyrimidine (T or C). When present in the core of the DNA helix, A and T are each capable of two hydrogen bond interactions in their most stable configuration, while G and C are capable of three hydrogen bond interactions. The AT/GC (or Watson-Crick) base pairing rules dictate that the most stable condition for a DNA double helix occurs when A is aligned and hydrogen bonded with T and G is aligned and hydrogen bonded with C. base: In a nucleic acid, the term "base" refers to a nucleoside. The bases in two RNA or DNA strands are the portions that interact in base pairing. In general chemistry, a base is hydrogen ion acceptor. Chemical bases give a low pH ("basic") solution when dissolved in water. A basic molecule is positively charged in aqueous solution at neutral pH. Despite the presence of the nucleosides, the overall charge on a nucleic acid polymer is negative at neutral pH, due to the highly negative charge on the phosphates of the backbone. beta prime subunit: one member of the pair of large subunits of many bacterial RNA polymerases. beta subunit: one member of the pair of large subunits of many bacterial RNA polymerases. catalyst: a compound that increases the rate of a chemical reaction by acting to decrease the activation energy necessary for the reaction to begin. Catalysts can be chemical compounds, such as the ammonium sulphate added to initiate polymerization of an acrylamide solution, or biological, such as the enzymes that mediate virtually all chemical reactions in a cell. cDNA library: a collection recombinant vector molecules containing inserts of DNA fragments synthesized from a mixture of mRNA molecules, generally by reverse transcriptase-mediated elongation of an oligo-dT primer annealed to the 3' poly-A tail of the mRNA molecules purified from a eukaryotic cell under a specific growth condition. These collections are tissue-specific in that they contain cDNA inserts that represent only the genes that were expressed at the time the mRNA was purified. cDNA: a DNA copy of an RNA molecule made by annealing an oligonucleotide primer to an RNA template and extending the primer with the enzyme reverse transcriptase in the presence of the deoxynucleoside triphosphates. cDNA: complementary DNA; a DNA molecule generated by reverse transcription from an RNA (generally mRNA) template. charge-to-mass ratio: this ratio significantly affects the mobility of a macromolecule through a solution when driven by an electric field (two molecules of identical mass but different charge will move at different rates in an electric field). Since at neutral pH, the majority of the net charge on DNA is derived from the negatively charged phosphate groups in the DNA backbone, as DNA increases in size, the total charge increases at the same rate. The resulting charge-to-mass ratio therefore remains constant, and DNA fragments of different sizes all move at about the same rate in an electric field. For separation of the fragments according to size, it is necessary to force the fragments to migrate through a molecular sieve or matrix of many small pores that allows the smaller fragments to move faster than the larger fragments. Agarose and polyacrylamide gels are most commonly used as a matrix for size separation of DNA and RNA fragments. chemical cleavage: DNA can be chemically cleaved by one of two common methods - acid depurination followed by hydrolysis, or methylation followed by incubation in pyridine. Acid depurination and hydrolysis introduces nicks into DNA, reducing the size of DNA fragments on denaturation, a step frequently employed in Southern blot transfer protocols and in the preparation of hybridization probes. Methylation/piperidine cleavage is an important step in Maxam-Gilbert sequencing and in chemical footprinting reactions. chemical method: (of nucleotide sequence determination) determination of nucleotide sequence by the Maxam-Gilbert method. chloramphenicol: a protein synthesis-inhibiting antibiotic sometimes used in the selection of bacterial transformants containing a cloning vector encoding resistance to this antibiotic, generally because of the presence of a chloramphenicol resistance gene derived from a transposable element. Resistance to this antibiotic is usually accomplished by means of chemical modification enzymatic acetylation of the chloramphenicol. It can also be used in the chloramphenicol-mediated amplification of the copy number of plasmids containing an origin of replication derived from ColE1. chromosomal attachment site: an area of a cell or nuclear membrane where a chromosome appears to be anchored to assist in replication and segregation of new chromosomes to progeny cells. cloning vector: an engineered DNA element that contains, at a minimum, an origin of replication to allow propagation in a host cell, a selectable marker to allow the identification of cells containing the molecule, and a site where additional DNA can be inserted without interfering with replication or selection properties. A bacterial cloning vector is generally a plasmid or a bacteriophage. cloning: A colony that grows from a single bacterium is said to be clonal. Molecular cloning is the process of inserting DNA fragments into a vector and generating recombinants, each of which contains only a few of the DNA fragments present in the original DNA sample. colony blot: a procedure in which an imprint of the colonies grown on the surface of a solid nutrient medium is transferred to a membrane and the cells lysed or disrupted, allowing the DNA or protein to bind to the membrane. Following appropriate treatment, the membrane can be exposed to either a hybridization probe for the identification of colonies containing a specific nucleic acid sequence or to an antibody for the identification of colonies containing a specific protein. complementation analysis: generally refers to the mixture of genes derived from two or more different mutants in an attempt to establish a chromosomal order or location of mutations. complementation: restoration of a damaged physical property or capability. Genetic complementation involves introduction of nucleotide sequences that ultimately, through one of several different mechanisms, restore gene function. Biochemical complementation generally involves the introduction of a protein component that restores function to an inactive protein complex. complexity: (of DNA) the total number of base pair combinations in a DNA fragment or DNA sample. For example, although both sequences contain 3 A's, 3 C's, 3 G's, and 3 T's, the sequence AATCTGCCAGTG is more complex than the sequence ACTGACTGACTG, which is a linear repeat of the sequence ACTG. covalently closed circular DNA: a double-stranded circular DNA molecule containing no nicks in the sugar-phosphate backbone. These molecules can contain various degrees of twisting stress around the axis of the DNA helix, which can cause the appearance of turns or superhelical twists to relieve the stress. CTP: See cytidine triphosphate. current: (used during electrophoresis) the amount of electricity passing through a circuit per unit time. Current (I) is measured in amperes ("amps", A), which are coulombs per second. The amount of current passing through a circuit (e.g., through an electrophoresis gel) depends on the voltage (V) and the resistance (R) according to the formula V=IR. The resistance of a gel depends on several parameters, including the cross-sectional area of the current path (usually corresponding to gel thickness) and the salt concentration of the buffer. Higher resistance (e.g., using lower salt concentrations) gives less current at a given voltage, and thus leads to less heat generation. Excessive heat can distort sample mobility or cause melting of an agarose gel matrix. cytidine triphosphate: a ribose molecule with the pyrimidine cytosine attached to the 1' carbon and a chain of three oxygenated phosphorus atoms attached to the 5' carbon. This is a high energy molecule that serves as a precursor for the assembly of RNA. cytosine: (C) a pyrimidine base found attached to the 1' carbon of deoxyribose in DNA and RNA, where it is capable of forming 3 hydrogen bond interactions with the purine guanine on an opposing nucleic acid strand. dATP: See deoxyadenosine triphosphate. dCTP: See deoxycytidine triphosphate. ddATP: See dideoxyadenosine triphosphate. ddCTP: See dideoxycytosine triphosphate. ddGTP: See dideoxyguanosine triphosphate. ddTTP: See dideoxyguanosine triphosphate. deoxyadenosine triphosphate: a deoxyribose molecule with the purine adenine attached to the 1' carbon and a chain of three oxygenated phosphorus atoms attached to the 5' carbon. This is a high energy molecule that serves as a precursor for the assembly of DNA. deoxycytidine triphosphate: a deoxyribose molecule with the pyrimidine cytosine attached to the 1' carbon and a chain of three oxygenated phosphorus atoms attached to the 5' carbon. This is a high energy molecule that serves as a precursor for the assembly of DNA. deoxyguanosine triphosphate: a deoxyribose molecule with the purine guanine attached to the 1' carbon and a chain of three oxygenated phosphorus atoms attached to the 5' carbon. This is a high energy molecule that serves as a precursor for the assembly of DNA. deoxynucleoside triphosphate: (dNTP = dATP, dCTP, dGTP, or dTTP) any of the precursors required for enzymatic sythesis of DNA. deoxyribonucleic acid: (DNA) A nucleic acid using deoxyribose as the sugar moiety in the backbone chain. DNA is the primary genetic material of most organisms. deoxyribose: (2 deoxyribose) the 5-carbon sugar that forms an integral part of the sugar-phosphate backbone of DNA and to which the nucleotide bases are attached at the 1', or first, carbon. This compound is structurally the same as ribose except for the absence of a hydroxyl residue at the 2', or second, carbon of deoxyribose, a feature that makes deoxyribose-phosphate polymers more stable than ribose-phosphate polymers. deoxythymidine triphoshate: a deoxyribose molecule with the pyrimidine thymine attached to the 1' carbon and a chain of three oxygenated phosphorus atoms attached to the 5' carbon. This is a high energy molecule that serves as a precursor for the assembly of DNA. dGTP: See deoxyguanosine triphosphate. dideoxyadenosine triphosphate: a nucleoside triphosphate analog (a dideoxynucleoside triphosphate) that causes termination of an elongating DNA molecule when incorporated by DNA polymerase in place of adenosine triphosphate. dideoxycytosine triphosphate: a nucleoside triphosphate analog (a dideoxynucleoside triphosphate) that causes termination of an elongating DNA molecule when incorporated by DNA polymerase in place of cytosine triphosphate. dideoxyguanosine triphosphate: a nucleoside triphosphate analog (a dideoxynucleoside triphosphate) that causes termination of an elongating DNA molecule when incorporated by DNA polymerase in place of guanosine triphosphate. dideoxynucleoside triphosphate: ddNTP.GIF a nucleoside triphosphate analog that causes termination of an elongating DNA molecule when incorporated by DNA polymerase because of the absence of a 3'-hydroxyl residue on the sugar portion of the compound, which is necessary for the formation of the 3' to 5' phosphate linkage in an elongating DNA chain. dideoxynucleotide sequencing: a method of nucleotide sequence determination that is dependent on the enzymatic elongation of a specific sequencing primer annealed to a template DNA with the elongation reaction performed in the presence of a base-specific chain-terminating nucleoside triphosphate analogs, such as a dideoxynucleoside triphosphate. Denaturing polyacrylamide gel electrophoresis of the chain-termination products generated from extension of the sequence primer resolves the DNA fragments in order of increasing size to generate a nested set of DNA fragments that reveals the nucleotide sequence of the DNA fragment. dideoxythymidine triphosphate: a nucleoside triphosphate analog (a dideoxynucleoside triphosphate) that causes termination of an elongating DNA molecule when incorporated by DNA polymerase in place of thymidine triphosphate. DNA fragment size standard: a DNA fragment or mixture of fragments of known size subjected to gel electrophoresis along with unknown DNA samples to enable preparation of a standard curve for estimation of the sizes of unknown fragments. DNA ligase: an enzyme that catalyzes sealing of breaks or nicks in the backbone of a DNA molecule. The E. coli DNA ligase, encoded by a gene in the Escherichia coli chromosome, requires DPN rather than ATP as a co-factor, and cannot ligate blunt or flush ends. The ATP-dependent DNA ligase encoded by bacteriophage T4 and synthesized during infection of Escherichia coli is capable of sealing breaks in association with 5' cohesive termini, 3' cohesive termini, or blunt ends that have no cohesive overlap. DNA polymerase: an enzyme capable of extending the 3' hydroxyl residue of an oligo- or polynucleotide primer annealed to a single-stranded DNA template, resulting in net synthesis of a complementary DNA strand. This is the only orientation in which DNA polymerization has been found to occur. DNA: Deoxyribonucleic acid. dNTP: See deoxynucleoside triphosphate. double-digestion: treatment of a nucleic acid sample, usually DNA, with either simultaneous or successive restriction enzymes with differing recognition cleavage sites to establish a restriction map of the DNA fragment. drug resistance gene: A gene conferring resistance to an antibiotic or class of antibiotics. These genes form the selective basis for distinguishing cells containing a vector from cells that do not, a key aspect of cloning technology. dTTP: See deoxythymidine triphoshate. EcoRI: restriction endonuclease purified from bacterial strain Escherichia coli RY13 recognizing the sequence GAATTC and cleaving after the first G to generate the four-base 5' cohesive terminus AATT. electroporation: a transformation method that accomplishes the introduction of DNA by using electric current to drive the DNA into the desired host. enzyme: a biological molecule that catylizes a specific chemical reaction. Most enzymes are proteins; a ribozyme is an enzyme composed of RNA. episomes: DNA elements that are capable of either replicating extrachromosomally or integrating into the host chromosome. Bacteriophage lambda, for example, is an episome that replicates extrachromosomally during the lytic, or progeny-producing, phase of life, but can integrate into the bacterial chromosome during the lysogenic phase. exon: a portion of a genomic DNA sequence that is transcribed and assembled as part of a mature mRNA molecule. exonuclease: a protein capable of removing nucleotides from the terminal end of a polynucleotide. A 5'->3' exonuclease removes nucleotides from the 5'-phosphate terminus, and a 3'->5' exonuclease removes them from the 3'-hydroxyl terminus. expression vector: a DNA cloning vector designed to accomplish the expression of protein from DNA inserts, usually by synthesizing the expressed protein as an extension of a carrier protein encoded by the vector. extrachromosomal: in addition to the chromosomes of a cell. Extrachromosomal propagation of DNA molecules is replication of a DNA molecule separate from the host chromosome. This replication may be completely independent of the chromosomal replication apparatus, or it may be strongly dependent on chromosomal replication protein factors. A bacterial plasmid is an example of an extrachromosomal replicative element. Many viruses (excluding those that integrate into the host genome, like retroviruses) replicate as extrachromosomal elements. fingerprint: The term "DNA fingerprint" refers to the DNA patterns generated by any of several methods used to detect sequence variations between different species or different individuals of the same species. A PCR fingerprint is the pattern of DNA bands that results when a set of oligonucleotide primers is used to PCR amplify a subset of DNA bands from a genome. The primers may be specific and designed to amplify DNA fragments corresponding to a particular combination of genes, or may be rather non-specific in that the identity of the amplified DNA fragments remains unknown. The intent of a PCR fingerprint is generally to generate a DNA fragment pattern characteristic of a particular species or individual. RFLP patterns can also be used for DNA fingerprinting. footprint: the region where a protein interacts with a polynucleotide, generally a double-stranded DNA fragment. The region is detected by the altered access of the DNA molecule to either enzymes, such as the endonuclease DNAseI, or to chemical agents, such as methylating compounds. frequency of enzyme cleavage: the statistical frequency or probability of occurrence of a site of N bases in length and containing no ambiguous bases can be estimated by the formula frequency = 1/(4)N. When ambiguous bases are present, such as in the five-base sequence AAPurineTT, the calculation must to take into account the allowance of either purine in the central position. frequency = 1/4 X 1/4 X 2/4 X 1/4 X 1/4. GC: Because GC base pairing has three hyrogen bonds compared to an AT pair's two bonds, the relative amount of G plus C (GC composition) in a DNA sample often correlates with the relative resistance of double-stranded DNA to denaturation. gel electrophoresis: the process of using an electric field to force charged macromolecules through a resolving matrix, causes the formation of bands contining molecules with similar mobility. gel: the semi-solid compound used to form a collection of fine pores (or gel matrix) through which macromolecules are forced to migrate during gel electrophoresis. gene family: a collection of similar gene products synthesized from different chromosomal loci. gene family: a collection of similar genes at different chromosomal loci. gene library: a collection of recombinants of sufficient number and size of DNA insert to ensure a high probability that all regions of chromosomal DNA from the organism will be present in the collection. gene: the heritable units of expression that encodes a physical characteristic of an organism and is passed from parents to progeny. A gene is the region of a chromosome where mutations all influence a single phenotypic trait that can be passed from parents to progeny. genetic information: information stored in genes and transmissible to an organism's offspring. genetic material: Maintaining a high degree of fidelity when storing genetic information is crucially important to the viability of an organism, since the rate at which the genetic information accumulates damage directly directly influences long-term survival. The primary genetic material of most organisms is DNA; organisms that can tolerate higher mutation rates (including certain viruses) may use RNA. genomic equivalent: the amount of DNA necessary to be present in a purified sample to guarantee that all genes will be present. This number increases with the total genome size of an organism and can be calculated by converting the size of a genome in base pairs to micrograms of DNA. GTP: See guanosine triphosphate. guanine: (G) a purine base found attached to the 1' carbon of deoxyribose in DNA and RNA, where it is capable of forming 3 hydrogen bond interactions with the pyrimidine cytosine on an opposing nucleic acid strand. guanosine triphosphate: a ribose molecule with the purine guanine attached to the 1' carbon and a chain of three oxygenated phosphorus atoms attached to the 5' carbon. This is a high energy molecule that serves as a precursor for the assembly of RNA haploid: possessing a single copy of the cellular chromosomes, as is the case for many bacteria and for the sex cells of most eukaryotes. heteroduplex: a substantially double-stranded nucleic acid molecule in which some regions have non-complementary base sequences and remain single-stranded. high-fidelity replication: the production of copies of a DNA molecule with the introduction of very few errors, a necessity for ensuring that progeny receive a full set of the functional genes from the parent organism. HindII: restriction endonuclease purified from bacterial strain Hemophilus inlfuenzae Rd, recognizing the sequence GTPyPuAC and cleaving in the middle of the sequence to generate blunt or flush termini. HindIII-digested bacteriophage lambda DNA: bacteriophage lambda DNA that has been purified and digested with the restriction endonuclease HindIII to generate a set of DNA fragment size standards to be used as standards during gel electrophoresis HindIII-digested bacteriophage lambda DNA: bacteriophage lambda DNA that has been purified and digested with the restriction endonuclease HindIII to generate a set of DNA fragment size standards to be used as standards during gel electrophoresis. HindIII: restriction endonuclease purified from bacterial strain Hemophilus inlfuenzae d, recognizing the sequence AAGCTT and cleaving after the first A to generate the four-base 5' cohesive terminus AGCT. histone: any of a group of small, basic proteins associated with maintaining the structure of chromosomes. homologous: a term used to describe nucleotide sequences that are very similar in structure or function, often encoding closely related gene products or serving similar regulatory roles during gene expression. Homologous genes produce very similar gene products in different organisms. The term is sometimes used with a more precise definition to mean genes that share a common evolutionary ancestor; saying two genes are "similar" does not imply any judgement about evolutionary relationship. homopolymer tail: when provided with only one of the four nucleoside triphosphates, terminal transferase will add a homopolymer extension of the provided nucleoside triphosphate (such as CCCCCCCCC when provided with only dCTP) to a DNA fragment, known as a homopolymer tail. This feature has been used to add complementary cohesive homopolymer termini to allow annealing and joining of two different DNA fragments with otherwise incompatible termini. the poly-A tail found in polyadenylated mRNA is an example of a naturally occurring homopolymer tail. host range: the variety of organisms into which a gene can be inserted and retain functionality. Plasmids with a very narrow host range, like colE1 and F-factor, will only function in Escherichia coli and closely related enteric bacteria, while plasmids with a very broad host range, like RP4, will function in a wide variety of distantly related Gram negative bacteria. host: an organism that will serve to maintain and propagate a DNA molecule. The vast majority of routine recombinant DNA work has been accomplished using the bacterium Escherichia coli as a host cell. hybridization: the process of allowing two nucleic acid strands to anneal. The term reflects the idea that if the two strands originate from different sources, their annealed product is a hybrid of the two originals. However, the term is commonly used to mean annealing or reannealing of two strands, even if they originate from the same source. Hybridization analysis is the process of using a labeled oligonucleotide or polynucleotide to detect complementary nucleotide sequences, a fundamental component of Northern blot, Southern blot, and library screening procedures. hydrogen bond: a noncovalent chemical interaction in which a hydrogen atom is "shared" between two electron donors. immunoblot: Western blot. insertional inactivation: the inactivation of a phenotype by insertion of a DNA fragment instability: (of a DNA fragment) Some DNA fragments tend to undergo recombination processes when cloned and transferred from their native host to a different organism. Sensitivity to host recombination processes, production of detrimental gene products, difficulty in replication of certain DNA sequences, and a variety of other factors can contribute to DNA instability in a new host. intron: (or intervening sequence) a spacer region of a genomic sequence that is transcribed into RNA during gene expression but removed during the process of RNA maturation. These regions typically separate the exons of a gene from one another and are absent from the mature mRNA molecule. See also exon. isozymes: two or more very similar biochemical activities encoded by independent genetic loci. lambda: a naturally occurring double-stranded bacteriophage with a linear genome of about 50,000 base pairs. This bacteriophage has been manipulated in vitro for the construction of many specialized cloning vectors that take advantage of the viral DNA packaging system to selectively clone specific size classes of DNA fragments or to facilitate screening for desired recombinants. library: see gene library. ligation: a nick-sealing reaction that requires ATP as an energy source. This reaction is mediated by the enzyme ligase, commonly the ligase from the bacetiophage T4 (T4 DNA ligase). locus: a chromosomal site involved in the production of a specific gene product. Loci are generally defined by analysis of the location of mutations. M13: a naturally occurring bacteriophage that contains a single-stranded circular genome of about 6400 bases that infects only enteric bacteria containing the F-factor or producing the F pilus protein. The infecting virus is converted to a double-stranded circular replicative form that can be purified and digested with restriction enzymes similar to bacterial plasmids. This virus has been manipulated in vitro for the construction of specialized cloning vectors that exist in a double-stranded form in the bacterial cell bit produce an infectious bacteriophage particle containing a single-stranded circular form, an excellent template for nucleotide sequence analysis. Maxam-Gilbert: inventors of a method of nucleotide sequence determination that is dependent on the sensitivity of methylated DNA nucleotides to chemical cleavage by piperidine. With this approach, an end-labeled DNA fragment is subjected to partial chemical methylation under four or more conditions to preferentially methylate A, C, G, and T, followed by chemical cleavage of the methylated bases with piperidine. Denaturing polyacrylamide gel electrophoresis of the cleavage products resolves the DNA fragments in order of increasing size to generate an end-labeled nested set of DNA fragments that reveals the nucleotide sequence of the labeled DNA fragment. mcs: See multiple cloning site. megaprimer: a term used to describe large polynucleotides, often themselves the initial product of a PCR reaction, that serve as primers for DNA synthesis, typically during the later stages of a multi-step PCR reaction designed to assemble a PCR DNA fragment of fairly large size from smaller DNA fragments. methylation: DNA in a cell can be subject to the action of various enzymes that modify DNA bases, most often by the addition of a methyl group to the base. This modification may be very specific, such as the sequence-specific methylation of restriction endonuclease cleavage sites by the corresponding modification methylase, or quite general, such as a routine methylation of cytosine by a particular organism. Treatment with a chemical methylating agent like dimethyl sulfate under different ionic conditions can cause the base-specific methylation of the different bases in DNA. microsequence variation: the slight differences in nucleotide sequence observed when the same chromosomal region is compared between two or more individuals, particularly when the individuals are of the same species. miniprep: rapid preparation of a small amount of partially purified DNA from a culture of cells, usually sufficient for a few miniscreen: rapid preparation of a small amount of partially purified DNA from a culture of cells, usually sufficient for a few experiments, typically involving digestion with restriction enzymes and examination by gel electrophoresis. modification methylase: an enzyme that recognizes a restriction endonuclease cleavage site and adds a methyl group to one or more of the bases within the site to prevent cleavage by the restriction enzyme. mRNA: messenger RNA, the RNA molecule that is used by the ribosome as a template for the assembly of protein. multiple cloning site: a genetically engineered collection of several different restriction enzyme cleavage sites that allow convenient insertion of DNA fragments into a cloning vector. mutation: a change in the arrangement or nucleotide sequence of a gene. nested primers: two oligonucleotide primers of different, usually non-overlapping, sequences that anneal to sites close together and in the same orientation on a particular DNA target sequence. When used in two successive PCR reactions, these primers can greatly enhance the specificity of the final amplification product. nested set: a collection of DNA or RNA fragments of different sizes derived from a larger polynucleotide, with all fragments sharing one common end. Of great importance to nucleotide sequence determination, the nested set in the Maxam-Gilbert method is defined by the end-label used to visualize the products of the chemical modification and cleavage reactions and in the Sanger method by the primer used for the enzymatic elongation and chain-termination reactions. non-phosphorylated termini: although most DNA contains a phosphate residue at the 5' terminus, the enzyme phosphorylase can remove that terminal phosphate, leaving a 5' hydroxyl residue. This reaction is frequently employed to block ligation, since the enzyme DNA ligase is unable to ligate a non- phosphorylated 5' terminus. Northern blot: the process in which the RNA bands present in a gel are transferred to a membrane and incubated with a hybridization probe to reveal the location of RNA bands complementary to the probe. nucleic acid: a polymer composed of nucleotide monomers. The backbone of a nucleic acid polymer has the structure sugar-oxygen-phosphate-oxygen-sugar. Deoxyribose is the sugar present in DNA and ribose the sugar present in RNA. The sugar molecules are modified by the presence of a purine or pyrimidine nucleoside or "base" attached to the first, or 1', carbon and the oxygen-phosphorus-oxygen bond links the third, or 3', carbon to the fifth, or 5', carbon of the adjacent sugar molecule. nucleoside: an N-glycosyl derivative of a heterocyclic base, typically deoxyribose attached to adenine (deoxyadenosine, dA), cytosine (deoxycytidine, dC), guanine (deoxyguanosine, dG), or thymine (thymidine, T or dT) in DNA and ribose attached to adenine (adenosine, A), cytosine (cytidine, C), guanine (guanosine, G), or uracil (uridine, U). nucleotide sequence map: a map that shows the position of restriction sites and important genetic features based on analysis of the nucleotide sequence of a DNA fragment. nucleotide: Nucleotides are the sugar-phosphate esters of nucleosides that are obtained by hydrolysis of nucleic acids, typically dAMP, dCMP, dGMP and dTMP from DNA and AMP, CMP, GMP, and UMP from RNA. offspring: Progeny. Genetic inheritance is the transmission of genetic information, and thus passage of genetically determined traits, to offspring. It is crucial to the viability of a species that the offspring receive functional copies of all of the genetic information of the parent organism. Processes of cell division and sexual reproduction must function in a manner that ensures an adequate degree of integrity of genetic information transmitted to progeny. oligonucleotide: a short, usually chemically synthesized polynucleotide. An oligonucleotide is typically 10 to 30 bases in size, but may be over 100 bases long. Synthetic oligonucleotides are frequently used as primers in Sanger dideoxy sequencing or PCR, or as probes to identify a gene sequence of interest. open circular DNA: a double-stranded circular DNA molecule that has been nicked in one of the strands to allow the release of any superhelical turns present in the molecule. The open circular form migrates more slowly during gel electrophoresis than a covalently closed circular, or supercoiled, molecule of the same size due to the associated differences in conformation, or shape, of the molecules. overlapping DNA termini: the ends of two DNA molecules which are complementary and capable of hybridization to one another. Such structures include the "sticky ends" left by compatible restriction enzymes. See cohesive terminus. PCR: See polymerase chain reaction. pH: the negative logarithm of the hydrogen ion concentration. High pH is a "basic" condition (low free hydrogen ion concentration), while low pH is an "acidic" condition. The pH of a solution has an extremely important influence on the higher order structure of many macromolecules, including both proteins and nucleic acids. The ability of two complementary DNA strands to remain associated with each other as a double-stranded molecule is pH dependent. Increasing the pH of a DNA solution tends to destabilize the base pairing interactions, forcing a double-stranded molecule towards the single-stranded state. Other factors influencing the stability of base pairing between DNA strands include salt concentration, temperature, the size of the complementary region, and the percentage of GC base pairs. phage: See bacteriophage. phenotype: a term used to describe the physical characteristics, traits, or metabolic capabilities of a cell. These characteristics can change as a result of the occurrence of mutations. phenotype: physical characteristics or capabilities of a cell. phenotypic screening: examination of the physical characteristics or properties of collection of recombinant transformants in the attempt to find a transformant cell containing a recombinant molecule that endcodes a specifc phenotypic trait. phosphatase: an enzyme that is capable of removing a phosphate residue from a substrate molecule, usually by hydrolysis. phosphorylated sugar backbone: the fundamental chemical composition of a nucleic acid is a polymer backbone composed of the structure sugar-oxygen-phosphate-oxygen-sugar where deoxyribose is the sugar present in DNA and ribose the sugar present in RNA. The sugar molecules are modified by the presence of a purine or pyrimidine base attached to the first, or 1', carbon and the oxygen-phosphorus-oxygen bond links the third, or 3', carbon to the fifth, or 5', carbon of the adjacent sugar molecule. phosphorylated termini: nucleic acid ends that have an attached phosphate group, most commonly existing in the form of a 5'-phosphate. physical characteristics of a cell: Phenotype piperidine: Incubation of methylated DNA with the chemical piperidine causes elimination of the methylated base and cleavage of the DNA strand at that point. This reaction is important to Maxam-Gilbert sequence analysis and to chemical footprinting studies that examine the interaction of DNA binding proteins with a target DNA sequence. plaque lift: a procedure in which an imprint of the plaques that appear in a surface layer of phage-sensitive indicator bacteria grown on the surface of a solid nutrient medium is transferred to a membrane, allowing the DNA or protein to bind to the membrane. Following appropriate treatment, the membrane can be exposed to either a hybridization probe for the identification of colonies containing a specific nucleic acid sequence or to an antibody for the identification of colonies containing a specific protein. plaques of infected cells: the zones of either lysed cells, as caused by bacteriophage lambda, or inhibited cell growth, as caused by bacteriophage M13, that occur in the surface of an indicator lawn of bacteriophage-sensitive cells in the presence of the bacteriophage particles released by infected cells. plasmid vector: a molecular cloning vector made from a plasmid. plasmid: an extrachromosomally replicating, circular piece of DNA. Plasmids are present in many strains of bacteria. Naturally occurring plasmids often confer resistance to various antibiotics or allow utilization of unusual nutritional sources. Natural plasmids have been used as the source of many of the DNA sequences that have been assembled in vitro to construct cloning vectors. polar: nucleic acids exhibit polarity in that they have a direction defined by the presence of the 5'-phosphate at one end of the molecule and the 3'-hydroxyl at the other. A mutation that is polar affects expression of genes that are located transcriptionally 3' of the location of the mutation by causing premature termination of transcription. (in general chemistry) Chemical compounds that are polar have regions of net positive or negative charge and tend to be soluble in water but not in uncharged organic solvents (such as chloroform and ether). polarity: (of a nucleic acid molecule) The single-stranded nucleic acid polymer has a polarity, or directionality, defined by the presence of the unpolymerized 5' carbon at one end of the molecule, which most often exists as a 5'-phosphate, and the unpolymerized 3' carbon at the other end of the molecule, which most often exists as a 3'-hydroxyl residue. By accepted convention, nucleic acids are indicated with the 5'-phosphate at the left end and the 3'-hydroxyl at the right end. poly-A tail: a stretch of adenosine residues that is post-transcriptionally attached to the 3' terminus of many eukaryotic mRNA molecules during the maturation process. polyacrylamide: a mixture of acrylamide monomer and bis-acrylamide polymerized together by the addition of a catalyst to form a solid matrix used for gel electrophoresis of macromolecules. polymerase chain reaction: an in vitro DNA synthesis procedure in which two oligonucleotide primers are annealed to a DNA template oriented so that the primers direct DNA synthesis on complementary, opposing strands towards each other. With successive cycles of DNA synthesis, denaturation, and repriming, the region between the primers accumulates exponentially as a double-stranded DNA fragments with the ends consisting of the oligonucleotide primers. polyploid: having multiple copies of a chromosome. polysachharide: a molecule consisting of sugar monomers polymerized together in any of a wide variety of combinations. Bacterial cell wall components, starch, and cellulose are all forms of polysaccharides. Because these compounds share certain properties with DNA and RNA, they can be common contaminants of nucleic acid preparations that can severely interfere with enzymatic manipulation of the nucleic acid. primer-dependent: requiring the presence of an oligonucleotide to serve as an initiation point for a particular reaction, typically DNA synthesis. Primer-dependent synthesis of DNA on an RNA template is mediated by the enzyme reverse transcriptase, and enzyme normally associated with the conversion of the RNA genome of a retrovirus to a DNA copy during the viral life cycle. primer-independent: not requiring the presence of an oligonucleotide to serve as an initiation point for a particular reaction, such as the process of RNA synthesis. Primer-independent synthesis of DNA has not been routinely demonstrated with the DNA polymerizing enzymes that have been examined. primer: a nucleic acid molecule that can anneal to a DNA or RNA template molecule and serve as the initiation point for DNA synthesis. A custom primer is generally a synthetic oligonucleotide, but naturally occuring nucleotides act as primers as well, both in vitro and in vivo. In vitro uses of primers include cDNA synthesis, Sanger dideoxy sequencing, and PCR. probe: an RNA or DNA molecule attached to a detection mechanism (such as a fluorescent, enzymatic, immunoreactive, or radioactive reporter molecule) that allows visualization of the molecule when it has annealed with a complementary DNA or RNA molecule. A hybridization probe is used to anneal to and identify the complementary nucleic acid sequence. processing: Before mRNA processing, a newly synthesized RNA molecule is a complementary copy of the DNA strand that served as the template for RNA synthesis. Processing or maturation of the RNA molecule to its final form can involve endo- or exonucleolytic cleavage or cleavage/resealing steps (splicing), that remove specific regions of the RNA molecule before the RNA becomes biologically functional. Since a cDNA molecule is generally synthesized using an mRNA molecule as a template, the cDNA sequence corresponds to that of the mature, or fully processed RNA molecule. Regions such as the extreme 5' terminus and initially transcribed intervening sequences are generally absent from an isolated cDNA molecule. Certain characteristic processing site sequence features, such as the junctions associated with removal of intervening sequences, may be retained in a cDNA molecule, but the biological significance of such features must be confirmed by comparison with the genomic DNA sequence. promoter: the nucleotide sequence at which RNA polymerase binds and initiates RNA synthesis. Promoters are important in controlling levels of gene expression. protease: an enzyme that is capable of degrading protein, generally by hydrolysis of the peptide bond backbone of protein. protein assembly machinery of a cell: the ribosome. protein complex: a collection of proteins that aggregate or associate with one another to form the enzymatically or structurally active form. protein contaminant: proteins that are inadvertently purified along with DNA or RNA and often interfere with subsequent nucleic acid manipulation and analysis. pseudouracil: a slightly modified form of the pyrimidine uracil that occurs in tRNA molecules. purine: the chemical structure from which adenine and guanine are derived. pyrimidine: the chemical structure from which cytosine, thymine, and uracil are derived. recombinant DNA: the collection of methods that allow the isolation, specific restriction enzyme fragmentation, rearrangement into new combinations by ligation, and propagation of nucleic acids; also, a DNA molecule generated by application of this methodology. regulatory region: although classically defined in terms of the presence of mutations that affect regulation of gene expression, this is now considered to be the region of a gene where RNA polymerase and other accessory transcription modulator proteins bind and interact to control RNA synthesis. Although the promoter is an integral part of the regulatory region, this region may also contain binding sites for proteins that function in either a positive or a negative modulating fashion and various nucleotide sequence features, such as attenuators, may contribute to regulation of transcription. regulatory region: although classically defined in terms of the presence of mutations that affect regulation of gene expression, this is now considered to be the region of a gene where RNA polymerase and other accessory transcription modulator proteins bind and interact to control RNA synthesis. Although the promoter is an integral part of the regulatory region, this region may also contain binding sites for proteins that function in either a positive or a negative modulating fashion and various nucleotide sequence features, such as attenuators, may contribute to regulation of transcription. renaturation: the process of two single-stranded nucleic acid molecules annealing or base pairing to form a double-stranded molecule. repetitive sequence element: any fairly short nucleotide sequences that is repeated many times, often in tandem arrays, in a genome. ATATATATATATATATATATATATAT and GATGATGATGATGATGATGAT are examples of simple repetitive sequence elements. replacement vector: A DNA cloning vector that takes advantage of the DNA packaging mechanism of bacteriophage lambda to replace a portion of the vector DNA with the desired insert DNA. This approach optimizes the generation of recombinant bacteriophage that contain DNA inserts larger than routinely possible with plasmid cloning vectors. replicase: a nucleic acid-synthesizing enzyme involved in the reproduction of a nucleic acid genome. This term is often applied to the fairly small, specialized polymerases encoded by viral genomes. replication origin: a DNA sequence, generally fairly host-specific, whose presence allows the initiation of DNA replication in a host cell. restriction endonuclease: An enzyme that is able to bind to and cleave DNA in a site-specific manner. restriction fragment length polymorphism: the change in the DNA fragment sizes observed when DNA from two different individuals is digested with the same restriction endonuclease, a result of nucleotide sequence differences between the individuals. restriction map: a chart or listing of relative positioning of restriction sites within a DNA molecule. restriction site: the nucleotide sequence at which a restriction endonuclease binds and cleaves DNA. More formally called a restriction endonuclease recognition site. reverse transcriptase: an RNA-dependant DNA polymerase. Reverse transcription is found in retroviruses, whose genome is composed of RNA, but goes through a phase of its life cycle in which its sequence information if converted to DNA. In vitro, reverse transcriptase is commonly used for cDNA synthesis. reverse transcription: the process of generating a DNA copy from an RNA template. An enzyme capable of mediating this reaction is a reverse transcriptase. reverse translation: the process of using the table of amino acid codons to predict the collection of nuleotide sequences that might code for a specific amino acid sequence. Because any of several codons may encode a particular amino acid, reverse translation generally provides an ambiguous sequence. This process is typically used for the design of hybridization probes or PCR primers for the isolation of DNA fragments that might encode a desired gene product. reverse translation: the process of using the table of amino acid codons to predict the collection of nuleotide sequences that might code for a specific amino acid sequence. This process is typically used for the design of hybridization probes or PCR primers for the isolation of DNA fragments that might encode a desired gene product. reverse translation: the process of using the table of amino acid codons to predict the collection of nuleotide sequences that might code for a specific amino acid sequence. (This process is not known to occur in nature.) Because any of several codons may encode a particular amino acid, reverse translation generally provides an ambiguous sequence. The predicted sequences are typically used for the design of hybridization probes (or PCR primers) for the detection (or amplification) of DNA fragments that might encode a desired gene product. RFLP: restriction fragment length polymorphism. rho subunit: the subunit of bacterial RNA polymerase that appears to be involved in termination of transcription at a class of sequences known as rho-dependent terminators. ribonuclease: a enzyme capable of cleaving or degrading RNA. ribonucleic acid: (RNA) A nucleic acid using ribose as the sugar moiety in the backbone chain. Some major uses of RNA in the cell are as constituents of the ribosome (rRNA), as transfer molecules temporarily linked to amino acids during protein synthesis (tRNA), and as messenger molecules transferring genetic information from the chromosome to the ribosome (mRNA). ribonucleoside triphosphate: (NTP) any of the four RNA precursor compounds ATP, CTP, GTP, and UTP. ribosome: A subcellular component which catalyzes translation of RNA sequences into proteins. Ribosomes are composed of proteins and ribosomal RNA (rRNA). RNA degradation: the disassembly of a polyribonucleotide by either chemical or enzymatic mechanisms. RNA polymerase: an enzyme or enzyme complex capable of synthesizing RNA. RNA polymerization: the assembly of ribonucleoside triphosphates into a polyribonucleotide. RNA template: an RNA molecule that serves as the annealing site for an oligonucleotide primer and directs the assembly of a complmentary polynucleotide, such as an mRNA template primed and used as a template for the synthesis of cDNA by reverse transcriptase. RNA-DNA hybrid: a double-stranded molecule in which a strand of DNA has annealed with or base paired with a complementary RNA molecule. RNA: Ribonucleic acid. RNAse H: protein capable of degrading the RNA from an RNA:DNA hybrid. S-adenosylmethionine: the chemical compound used as a co-factor by many Type I restriction endonucleases and other DNA methylating enzymes. S1 nuclease: an enzyme capable of degrading single-stranded but not double-stranded nucleic acids. salt: (in a DNA solution) The ability of two complementary DNA strands to remain associated with each other as a double-stranded molecule is dependent on several factors, including the amount of salt in the solution, the pH of the solution, the temperature of the solution, the size of the complementary region, and the percent GC base pairing in the complementary region. Decreasing the concentration of salt in a DNA solution tends to destabilize the base pairing interactions, forcing a double-stranded molecule towards the single-stranded state. SAM: S-adenosylmethionine. Sanger: inventor of the method of determination of nucleotide sequence by the enzymatic chain-termination. See dideoxynucleotide sequencing. satellite sequence: any DNA sequence that is repeated at such high copy number in the genome of an organism that it will form a band isolated from the bulk of the chromosomal DNA during equilibrium buoyant density gradient centrifugation. screening: the process of searching through a library or other collection of recombinant transformants in the attempt to identify a clone containing a recombinant vector containing at least a portion of the gene recognized by the probe. Screening by hybridization uses a nucleic acid probe to identify clones with a particular gene sequence. Antibody screening is the process of using an antibody against a specific protein target to attempt to locate a clone expressing that protein. A library used for antibody screening must be constructed with an expression vector. selective marker: a gene that encodes a product whose expression allows detection of the presence of the selective marker in a host cell. Resistance to antibiotics, growth in the presence of a specific nutrient, and the formation of plaques of infected cells on a sensitive lawn of host cells are all selective markers that have been employed in the construction of cloning vectors. sequence identity: a term that has been used in reference to the degree of similarity between two or more nucleotide sequences, generally in the context of "percentage of nucleotide sequence identity". sequence-specific cleavage: introduction of a nick in the sugar-phosphate backbone of RNA or DNA only where a particular nucleic acid sequence is present. sequence: the order of monomeric units in biological polymer (typically DNA or protein). In DNA and RNA molecules, genetic information is contained in the order of the nucleotide bases attached to the sugar-phosphate backbone of the molecule. The order of these bases is consequently probably the single most important biological aspect of DNA structure. The sequence of amino acids in a protein is sometimes referred to as "primary structure". shuttle vector: a cloning vector that contains more than one origin of replication, allowing function of the vector in different host cells. Most shuttle vectors contain an origin and selectable marker that allow routine propagation in Escherichia coli and an origin and selectable marker that allow transfer to the organism for which the DNA inserts are to be cloned, thereby allowing examination of the function of cloned DNA fragments in the original host environment. sigma subunit: the subunit of the RNA polymerase complex that is responsible for conferring recognition specificity to the initiation of RNA synthesis on a DNA template. silver stain: a process in which silver salts are used to stain and visualize various biological macromolecules, including nucleic acids and proteins. single-stranded: a polynucleotide molecule or portion of a polynucleotide molecule that is not annealed to a complementary polynucleotide molecule. site-specific ribonucleases: proteins that recognize a specific nucleotide sequence and introduce a nick in the sugar-phosphate backbone of RNA. Southern blot: the process in which the DNA bands present in a gel are denatured, transferred to a membrane, and incubated with a hybridization probe to reveal the location of DNA bands complementary to the probe. splicing: the intron removal step of mRNA processing. The unprocessed RNA molecule must be cleaved to remove the intron, and resealed (ligated). The endonuclease and ligase activities involved is splicing are performed by ribonucleoprotein complexes. In most cases, introns must be removed must be removed before the mRNA becomes biologically functional. standard curve: a graph prepared by plotting the migration of a set of known macromolecules (DNA, RNA, or protein) and used to estimate the size of unknown macromolecules by comparing their migration to that of the known macromolecules. star activity: a less specific recognition and cleavage activity that can result when restriction enzyme digestion reaction conditions are modified. The enzyme EcoRI, for example, recognizes the sequence GAATTC and cleaves between the G and A to generate the four-base cohesive overlap AATT, while EcoRI star activity (EcoRI*) recognizes the sequence AATT and cleaves to the left of the first A to generate the four-base cohesive overlap AATT. The recognition of addtional sites by the star activity causes the production of smaller DNA fragments than does recognition of the "normal" cleavage site alone. Star activity does not always cleave at all sites at the same rate, often resulting in production of non-stoichiometric, or non-equimolar, yields of DNA fragment digestion products. sticky end: See cohesive terminus. stoichiometric: A chemical term meaning that the molecules referred to are present in constant proportions; for nucleic acids this generally equates to equal numbers of molecules. Complete digestion of a DNA fragment with a restriction enzyme dictates that all resulting smaller DNA fragments derived from the original band should be stoichiometric, or present in the same number, with the relative staining intensity of each band proportional to fragment size following gel electrophoresis. Bands that are not present in stoichiometric levels are indicative of digestion artefacts, such as contaminating DNA fragments, incomplete enzyme activity, or contaminating enzyme activity. stringency: (of annealing conditions during hybridization) the amount of base complementarity that must exist for two single-stranded nucleic acids to anneal to form a double-stranded molecule under a specific set of ioninc, pH, and temperature conditions. structural components: (of a cell) the compounds that are necessary for maintaining the shape of a cell, typically a combination of polysaccharides and proteins. subcloning: large DNA fragments inserted into a vector for propagation often contain more nucleotide sequence than necessary for particular uses. Restriction enzyme digestion or PCR are often used to isolate and clone smaller DNA fragments from the original large DNA fragment, a process known as subcloning. sugar phosphate backbone: phosphorylated sugar backbone which connects together the monomeric units of DNA and RNA molecles. supercoiled DNA: a DNA molecule, containing superhelical twists. Supercoiled plasmid DNA is generally circular; if the circle is nicked in either or both strands, the twists can relax or unwind. synthesis of DNA: the net assembly of a polydeoxynucleotide. In a biological system, this process generally requires the four precursor deoxynucleoside triphosphates, a DNA template with an annealed DNA synthesis primer, and the enzyme DNA polymerase (which may be reverse transcriptase in some viral systems). DNA synthesis can be done enzymatically in vitro (as in PCR), or chemically (as in oligonucleotide synthesis). Assembly of the DNA chain has been found to always occur only in the 5' to 3' orientation, extending the 3'-hydroxyl of the primer along the template by adding residues complemetary to the template nucleotide sequence. T4: a bacteriophage with a fairly complex genome that causes the synthesis of many virus-encoded proteins during the infection of the host bacterium Escherichia coli. Of particular interest due to their use in in vitro DNA manipulation are the enzymes T4 DNA ligase, T4 polynucleotide kinase, and T4 DNA polymerase. Taq DNA polymerase: the thermostable DNA polymerase purified from the thermophilic bacteria Thermus acquaticus, frequently used to form PCR. Taq polymerase: See Taq DNA polymerase. The omission of the term "DNA" makes this an imprecise shorthand, since there are RNA polymerases in Thermus acquaticus as well. Taq: notation used to name enzymes derived fom Thermus acquaticus. The most important of these is Taq DNA polymerase. temperature of DNA solution: the ability of two complementary DNA strands to remain associated with each other as a double-stranded molecule is dependent on several factors, including the amount of salt in the solution, the pH of the solution, the temperature of the solution, the size of the complementary region, and the percent GC base pairing in the complementary region. Increasing temperature destabilizes base pairing interactions, forcing a double-stranded molecule towards the single-stranded state. template-independent DNA synthesis: net synthesis of DNA in the absence of a template. A few enzymes have been found to be capable of generating a random polymer in the absence of a template. The most significant of these enzymes, terminal transferase, will extend the 3'-hydroxyl terminus of a DNA molecule by the addition of whatever nucleoside triphosphates are present. When provided with only one of the four nucleoside triphosphates, terminal transferase will add a homopolymer extension ( such as CCCCCCCCC when provided with only dCTP) to a DNA fragment, known as a homopolymer tail, a feature that has been used to add complementary cohesive homopolymer termini to allow annealing and joining of two different DNA fragments with otherwise incompatible termini. template: a polynucleotide sequence from which information is read to direct synthesis of another macromolecule. This can refer to the DNA strand being copied during DNA synthesis or transcription of RNA, to the RNA strand being copied during reverse translation. The term template is (less commonly) used to refer to the mRNA strand during protein translation. Templates are used both in vivo processes, such as DNA replication and RNA transcription, and in vitro processes, such as PCR amplification and DNA footprinting. Since PCR requires primers annealed to a DNA template, PCR detection of RNA must be accomplished in two steps: the initial reverse transcriptase mediated production of a cDNA molecule corresponding to the desired RNA, followed by the subsequent use of that cDNA as a template for PCR amplification of an internal portion of the desired nucleotide sequence. terminal deletion: (of a DNA fragment) removal of nucleotides from either the 5'-phosphate or the 3'-hydroxyl terminal end of a DNA molecule. These deletions can be enzymatically generated with restriction enzymes, endonucleases, exonucleases, and a variety of PCR-based strategies. Such deletions are often constructed to facilitate nucleotide sequence analysis or to investigate the role of the deleted region in some aspect of gene structure or function. terminal transferase: an enzyme capable of template-independent DNA synthesis; that is, adding residues to the 3'-hydroxyl terminus of a DNA molecule even without a template strand. Certain DNA polymerases have limited terminal transferase activity. termination of transcription: just as RNA polymerases require specific signals for initiation of RNA synthesis on a DNA template, these enzymes may require specific signals that end transcription and cause the polymerase to release from the DNA template. tetracycline: a protein synthesis-inhibiting antibiotic occasionally used in the selection of bacterial transformants containing a cloning vector encoding resistance to this antibiotic, generally because of the presence of a tetracycline resistance gene derived from a transposable element. Resistance is generally accomplished by blocking entry of tetracycline into the host cell, rather than by inactivation of the antibiotic. thermostable DNA polymerase: any DNA polymerase capable of retaining biological activity at very high temperatures (80-100OC). Thermus acquaticus: a thermophilic bacterium that grows in very high temerature conditions. This bacterium is the source of several useful enzymes, such as Taq DNA polymerase and the restriction enzyme TaqI. thymine: (T) a pyrimidine base found attached to the 1' carbon of deoxyribose in DNA, where it is capable of forming 2 hydrogen bond interactions with the purine adenine on an opposing nucleic acid strand. Ti plasmid: a very large plasmid that occurs naturally in crown gall tumor-inducing strains of Agrobacterium tumefaciens. transcription initiation: RNA polymerase begins the synthesis of RNA on a DNA template at a specific nucleotide sequence termed a promoter. The initiation process can be very complex, requiring not only the presence of RNA polymerase but also additional accessory transcription factors that may function in both positive and negative roles in modulating RNA synthesis. transcription: template-dependant synthesis of RNA by RNA polymerase.The template gene is usually DNA, though there are also RNA-dependant RNA polymerases used, for example, by certain viruses. This process produces a RNA molecule complementary to one of the template strands. transduction: a change in phenotype caused by the introduction of DNA into the host chromosome in association with a bacteriophage entry mechanism. transfection: the introduction of infectious DNA, such as bacteriophage lambda DNA, into a host cell capable of propagating the infectious DNA, usually by the production and dissemination of phage or virus particles. transformant: a cell whose phenotypic properties have been altered, generally by the introduction of new DNA sequences. transformation: in classical genetic terms, the introduction of DNA into a host organism accompanied by a resultant change in phenotype. This term is commonly used to refer to the process of DNA introduction alone. translation: (of RNA sequence information into protein.) Protein is assembled by ribosomes that use the linear order of nucleotide bases present on a template messenger RNA molecule to direct the order of addition of amino acid residues to a growing polypeptide chain. transposable element: DNA element that resides in a larger piece of DNA and is capable of giving rise to a new copy that will be inserted into a new DNA location. These elements generally encode a gene for a transposase, a key protein in the insertion mechanism, and a selectable marker, such as resistance to an antibiotic, allowing detection of the element. The insertion of such an element within the coding region of a gene causes an insertion mutation, a change in phenotype due to the disruption of the gene by the inserted sequence. When disruption of phenotype is complete, the insertion event causes insertional inactivation. transposon: See transposable element. TTP: thymidine triphosphate, a deoxyribose molecule with the pyrimidine thymine attached to the 1' carbon and a chain of three oxygenated phosphorus atoms attached to the 5' carbon. This is a high energy molecule that serves as a precursor for the assembly of DNA. two-fold rotational symmetry: a double-stranded nucleic acid where the 5' to 3' nucleotide sequence on one strand is identical to that on the complementary strand. type I restriction endonuclease: typically large proteins that have more than one subunit, that require S-adenosylmethionine, ATP, and magnesium, that are able to both cleave and modify DNA in a site-specific manner, and have a relatively slow in their rate of action when purified. type I restriction enzyme: type I restriction endonuclease. type II restriction endonuclease: typically small proteins that have a single subunit, require magnesium (or another divalent metal ion) but no other co-factors for activity, and are able to cleave DNA in a site-specific manner with a relatively high rate when purified. These are accompanied in the cell by a corresponding restriction modification enzyme, generally a methylase, that recognizes and modifies the same sequence to prevent cleavage by the restriction endonuclease. type II restriction enzyme: type II restriction endonuclease. ultraviolet light: (UV) light in the wavelength range of 280 to 320 nanometers that is used to illuminate DNA and RNA samples bound wit fluorescent dyes, such as ethidium bromide, allowing visualization of the nucleic acids. uracil: (U) a pyrimidine base found attached to the 1' carbon of ribose in RNA, where it is capable of forming 2 hydrogen bond interactions with the purine adenine on an opposing nucleic acid strand. UTP: uracil triphosphate, a ribose molecule with the pyrimidine uracil attached to the 1' carbon and a chain of three oxygenated phosphorus atoms attached to the 5' carbon. This is a high energy molecule that serves as a precursor for the assembly of RNA. vacuole: membrane-bounded structure within a cell that typically contains collections of specific proteins required for specialized cellular functions. virus replication: the process of reproducing of the virus genome. virus: a subcellular infectious organism. Viruses have highly specialized nucleic acid genomes generally packaged in protein or proteolipid coats or capsules that are capable of inserting the genome into a susceptible host cell, where the genome is able to replicate and produce progeny to be released by the infected cell. voltage: (used during electrophoresis) The electromotive force (voltage) applied to drive charged molecules through a gel matrix in order to separate the molecules by size and/or charge during electrophoresis. Proper voltage can be critical to the resolution of different species in a mixed sample. A very low voltage may allow diffusion of samples and loss of band resolution, while a very high voltage can distort sample mobility. Excessive power (Watts = voltage times current) can generate excessive heat, and distort sample mobility or melt an agarose gel matrix. Western blot: the process in which the protein bands present in a polyacrylamide gel are electrophoretically transferred to a membrane, incubated with a primary antibody directed against a specific protein target, then incubated with a labeled secondary antibody (or comparable protein) directed against the primary antibody to reveal the location of any primary antibody:protein complex, allowing identification of protein bands recognized by the primary antibody. X-ray diffraction: the helical structure of DNA was proposed nearly 40 years ago based on the study of the diffraction of X-rays by crystals of DNA. The decades of subsequent DNA studies fundamentally support the basic structure as originally proposed. yield problem: the dilemma that as a genome increases in relative size, an individual DNA fragment becomes a smaller percentage of a DNA sample, making direct isolation of an individual DNA fragment technically impossible from a large genome.